produces PCA on genotypes from fasta files (popPhyl's ID format)

Overview

popPhyl_PCA

Performs PCA of genotypes.
Works in two steps.

1. Input file

A single fasta file containing different loci, in different populations/species. Not necessarily sorted.
The ID (the line starting by >) of each sequence has to respect the following format:
`

E24_99631_p1|arabidopsis|E15|Allele_1 NNNNNNNNNNNAAAGAAGATGGCGTCGGCAGTTTCAGTATCGTTTATTGTGGTGAATATT TTGCTTCTCCTGGTTCAGGTCTTTGCTGGGAGAGACTTTTACAAAATATTGGGAGTTCCC AGAAACGCCGATTTGAAACAAATCAAGCGATCCTATCGAAAGCTGGCCAAAGAACTCCAC CCAGATAAGAACAAAGATGATCCTGAAGCAGAACAAAGATTTCAAGACTTAGGTGCTGCT ` Four different fields separated by a pipe (|), where:

  1. first field is the locus name (E24_99631_p1).
  2. second field is the species name (arabidopsis).
  3. third field is the name of the sampled diploid individual (E15).
  4. fourth field is the name of the allele (two alleles per individual, named either Allele_1 or Allele_2)

1. PCA

Single python command line (popphyl2PCA.py).
Before, you need to have these python dependencies available:

  1. pandas
  2. sklearn
  3. biopython

python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py [name of the subdirectory created by the script where output files will be written] [name of the input fasta file]

Example:
python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py ~/Documents/PCA/testPCA ~/Programmes/popPhyl_PCA/test.fas
Can takes between 10 minutes and 2 hours, depending on the number of SNPs and individuals.

2. vizualisation

Little Shiny interface (plotPCA.R).
Before, you need to have these R dependencies available:

  1. shiny
  2. plotly
  3. tidyverse
  4. shinycssloaders

Then, in R:

  1. source(~/Programmes/popPhyl_PCA/plotPCA.R)
  2. shinyApp(ui=ui, server=server)
  3. upload the files with coordinates (table_coord_PCA_genotypes.txt) and eigen values (table_eigen_PCA_genotypes.txt)
Owner
camille roux
PostDoc in Population Genomics; Speciation; Hybridization; Evolution of sex chromosomes; Backward+forward simulations.
camille roux
🚧Useful shortcuts for simple task on windows

Windows Manager A tool containg useful utilities for performing simple shortcut tasks on Windows 10 OS. Features Lit Up - Turns up screen brightness t

Olawale Oyeyipo 0 Mar 24, 2022
tade is a discussion/forum/link aggregator application. It provides three interfaces: a regular web page, a mailing list bridge and an NNTP server

tade is a discussion/forum/link aggregator application. It provides three interfaces: a regular web page, a mailing list bridge and an NNTP server

Manos Pitsidianakis 23 Nov 04, 2022
A (very dirty) experiment to remove layers from a Docker image.

Surgically remove layers from a Docker image (with a chainsaw)

Jérôme Petazzoni 9 Jun 08, 2022
NFT-Generator is the best way to generate thousands of NFTs quick and easily with Python.

NFT-Generator is the best way to generate thousands of NFTs quick and easily with Python. Just add your files, set your configuration and run the scri

78 Dec 27, 2022
Helper script to bootstrap a Python environment with the tools required to build and install packages.

python-bootstrap Helper script to bootstrap a Python environment with the tools required to build and install packages. Usage $ python -m bootstrap.bu

Filipe Laíns 7 Oct 06, 2022
Lark is a parsing toolkit for Python, built with a focus on ergonomics, performance and modularity.

Lark is a parsing toolkit for Python, built with a focus on ergonomics, performance and modularity.

Lark - Parsing Library & Toolkit 3.5k Jan 05, 2023
A program to convert celcius to faranheit. made with python

Temp-Converter What is Temp-Converter Temp-Converter is little program made with pyhton to convert celcius to faranheit. Needed A python interpreter P

Chandula Janith 0 Nov 27, 2021
Allows you to canibalize methods from classes effectively implementing trait-oriented programming

About This package enables code reuse in non-inheritance way from existing classes, effectively implementing traits-oriented programming pattern. Stor

1 Dec 13, 2021
A collection of resources/tools and analyses for the angr binary analysis framework.

Awesome angr A collection of resources/tools and analyses for the angr binary analysis framework. This page does not only collect links and external r

105 Jan 02, 2023
cpp20.py is a Python script to compile C++20 code using modules.

cpp20.py is a Python script to compile C++20 code using modules. It browses the source files to determine their dependencies. Then, it compiles then in order using the correct flags.

Julien VERNAY 6 Aug 26, 2022
Exports the local variables into a global dictionary for later debugging.

PyExfiltrator Julia’s @exfiltrate for Python; Exports the local variables into a global dictionary for later debugging. Installation pip install pyexf

6 Nov 07, 2022
An OData v4 query parser and transpiler for Python

odata-query is a library that parses OData v4 filter strings, and can convert them to other forms such as Django Queries, SQLAlchemy Queries, or just plain SQL.

Gorilla 39 Jan 05, 2023
Backup a folder to an another folder by using mirror update method.

Mirror Update Backup Backup a folder to an another folder by using mirror update method. How to use Install requirement pip install -r requirements.tx

1 Nov 21, 2022
Automatic generator of readmes for git repositories (Includes file' listing)

Readme Generator We are bored of write the same things once and once again. We trust in the comments made inside of our files, and we decided to autom

Natalia Vera Duran 6 Jul 20, 2021
A hashtag from string extract python module

A hashtag from string extract python module

Fayas Noushad 3 Aug 10, 2022
The Black shade analyser and comparison tool.

diff-shades The Black shade analyser and comparison tool. AKA Richard's personal take at a better black-primer (by stealing ideas from mypy-primer) :p

Richard Si 10 Apr 29, 2022
This is a python table of data implementation with styles, colors

Table This is a python table of data implementation with styles, colors Example Table adapts to the lack of data Lambda color features Full power of l

Урядов Алексей 5 Nov 09, 2021
SysInfo is an app developed in python which gives Basic System Info , and some detailed graphs of system performance .

SysInfo SysInfo is an app developed in python which gives Basic System Info , and some detailed graphs of system performance . Installation Download t

5 Nov 08, 2021
Python tool to check a web applications compliance with OWASP HTTP response headers best practices

Check Your Head A quick and easy way to check a web applications response headers!

Zak 6 Nov 09, 2021
Export watched content from Tautulli to the Letterboxd CSV Import Format

Export watched content from Tautulli to the Letterboxd CSV Import Format

Evan J 5 Aug 31, 2022