AptaMat is a simple script which aims to measure differences between DNA or RNA secondary structures.

Overview

AptaMAT

Purpose

AptaMat is a simple script which aims to measure differences between DNA or RNA secondary structures. The method is based on the comparison of the matrices representing the two secondary structures to analyze, assimilable to dotplots. The dot-bracket notation of the structure is converted in a half binary matrix showing width equal to structure's length. Each matrix case (i,j) is filled with '1' if the nucleotide in position i is paired with the nucleotide in position j, with '0' otherwise.

The differences between matrices is calculated by applying Manhattan distance on each point in the template matrix against all the points from the compared matrix. This calculation is repeated between compared matrix and template matrix to handle all the differences. Both calculation are then sum up and divided by the sum of all the points in both matrices.

Dependencies

AptaMat have been written in Python 3.8+

Two Python modules are needed :

These can be installed by typing in the command prompt either :

./setup

or

pip install numpy
pip install scipy

Use of Anaconda is highly recommended.

Usage

AptaMat is a flexible Python script which can take several arguments:

  • structures followed by secondary structures written in dotbracket format
  • files followed by path to formatted files containing one, or several secondary structures in dotbracket format

Both structures and files are independent functions in the script and cannot be called at the same time.

usage: AptaMAT.py [-h] [-structures STRUCTURES [STRUCTURES ...]] [-files FILES [FILES ...]] 

The structures argument must be a string formatted secondary structures. The first input structure is the template structure for the comparison. The following input are the compared structures. There are no input limitations. Quotes are necessary.

usage: AptaMat.py structures [-h] "struct_1" "struct_2" ["struct_n" ...]

The files argument must be a formatted file. Multiple files can be parsed. The first structure encountered during the parsing is used as the template structure. The others are the compared structures.

usage: AptaMat.py -files [-h] struct_file_1 [struct_file_n ...]

The input must be a text file, containing at least secondary structures, and accept additional information such as Title, Sequence or Structure index. If several files are provided, the function parses the files one by one and always takes the first structure encountered as the template structure. Files must be formatted as follows:

>5HRU
TCGATTGGATTGTGCCGGAAGTGCTGGCTCGA
--Template--
((((.........(((((.....)))))))))
--Compared--
.........(((.(((((.....))))).)))

Examples

structures function

First introducing a simple example with 2 structures:

AptaMat : 0.08 ">
$ AptaMat.py -structures "(((...)))" "((.....))"
 (((...)))
 ((.....))
> AptaMat : 0.08

Then, it is possible to input several structures:

AptaMat : 0.08 (((...))) .(.....). > AptaMat : 0.2 (((...))) (.......) > AptaMat : 0.3 ">
$ AptaMat.py -structures "(((...)))" "((.....))" ".(.....)." "(.......)"
 (((...)))
 ((.....))
> AptaMat : 0.08

 (((...)))
 .(.....).
> AptaMat : 0.2

 (((...)))
 (.......)
> AptaMat : 0.3

files function

Taking the above file example:

$ AptaMat.py -files example.fa
5HRU
Template - Compared
 ((((.........(((((.....)))))))))
 .........(((.(((((.....))))).)))
> AptaMat : 0.1134453781512605

Note

Compared structures need to have the same length as the Template structure.

For the moment, no features have been included to check whether the base pair is able to exist or not, according to literature. You must be careful about the sequence input and the base pairing associate.

The script accepts the extended dotbracket notation useful to compare pseudoknots or Tetrad. However, the resulting distance might not be accurate.

You might also like...
The Spark Challenge Student Check-In/Out Tracking Script

The Spark Challenge Student Check-In/Out Tracking Script This Python Script uses the Student ID Database to match the entries with the ID Card Swipe a

Python script to automate the plotting and analysis of percentage depth dose and dose profile simulations in TOPAS.

topas-create-graphs A script to automatically plot the results of a topas simulation Works for percentage depth dose (pdd) and dose profiles (dp). Dep

Flenser is a simple, minimal, automated exploratory data analysis tool.

Flenser Have you ever been handed a dataset you've never seen before? Flenser is a simple, minimal, automated exploratory data analysis tool. It runs

Datashredder is a simple data corruption engine written in python. You can corrupt anything text, images and video.
Datashredder is a simple data corruption engine written in python. You can corrupt anything text, images and video.

Datashredder is a simple data corruption engine written in python. You can corrupt anything text, images and video. You can chose the cha

WithPipe is a simple utility for functional piping in Python.

A utility for functional piping in Python that allows you to access any function in any scope as a partial.

Data Scientist in Simple Stock Analysis of PT Bukalapak.com Tbk for Long Term Investment
Data Scientist in Simple Stock Analysis of PT Bukalapak.com Tbk for Long Term Investment

Data Scientist in Simple Stock Analysis of PT Bukalapak.com Tbk for Long Term Investment Brief explanation of PT Bukalapak.com Tbk Bukalapak was found

My first Python project is a simple Mad Libs program.
My first Python project is a simple Mad Libs program.

Python CLI Mad Libs Game My first Python project is a simple Mad Libs program. Mad Libs is a phrasal template word game created by Leonard Stern and R

simple way to build the declarative and destributed data pipelines with python

unipipeline simple way to build the declarative and distributed data pipelines. Why you should use it Declarative strict config Scaffolding Fully type

Generates a simple report about the current Covid-19 cases and deaths in Malaysia

Generates a simple report about the current Covid-19 cases and deaths in Malaysia. Results are delay one day, data provided by the Ministry of Health Malaysia Covid-19 public data.

Comments
  • Allow comparison with not folded secondary structure

    Allow comparison with not folded secondary structure

    User may want to perform quantitative analysis and attribute distance to non folded oligonucleotides against folded anyway for example in pipeline. Different solution can be considered:

    • Give a default distance value to unfolded vs folded structure (worst solution)
    • Distance must be equal to the maximum number of base pair observable : len(structrure)//2. Several issues could arise from this:
      • How to manage with enhancement #7 ? Take the largest ? Shortest ?
      • It would give abnormally high distance value and will remains constistent even though different structure folding are compared to the same unfolded structure. Considering our main advantage over others algorithm, failed to rank at this point is not good.
    • Assign Manhattan Distance for each point in matrix ( the one showing folding) the farthest theoretical + 1 in the structure. This may give a large distance between the two structures no matter the size and the + 1 prevent an equality one distance with an actually folded structure showing the same coordinate than the farthest theoretical point. Moreover, we can obtain different score when comparing different folding to the same unfolded structure.
    enhancement 
    opened by GitHuBinet 0
  • Different length support and optimal alignment

    Different length support and optimal alignment

    Allow different structure length alignment. This would surely needs an optimal structure alignment to make AptaMat distance the lowest for a shared motif. Maybe we should consider the missing bases in the score calculation.

    enhancement 
    opened by GitHuBinet 0
  • Is the algorithm time consuming ?

    Is the algorithm time consuming ?

    Considering the expected structure size (less than 100n) the calculation run quite fast. However, theoretically the calculation can takes time when the structure is larger with complexity around log(n^2). Possible improvement can be considered as this time complexity is linked with the double browsing of dotbracket input

    • [ ] Think about the possibility of improving this bracket search.
    • [ ] Study the .ct notation for ssNA secondary structure (see in ".ct notation" enhancement)
    • [x] #6
    • [ ] Test the algorithm with this new feature
    question 
    opened by GEC-git 0
  • G-quadruplex/pseudoknot comprehension

    G-quadruplex/pseudoknot comprehension

    Add features with G-quadruplex and pseudoknot comprehension. This kind of secondary structures requires extended dotbracket notation. https://www.tbi.univie.ac.at/RNA/ViennaRNA/doc/html/rna_structure_notations.html

    The '([{<' & string.ascii_uppercase is already included but some doubt remain about the comparison accuracy because no test have been done on this kind of secondary structure

    • [ ] Perform some try on Q-quadruplex & pseudoknots and conclude about comparison reliability. /!\ The complexity comes from the G-quadruplex structures. The tetrad can form base pair in many different way and some secondary structure notation can be similar. Here is an exemple of case with the same interacting Guanine GGTTGGTGTGGTTGG ([..[)...(]..]) ((..)(...)(..))
    • [x] #5
    enhancement invalid 
    opened by GEC-git 0
Releases(v0.9-pre-release)
  • v0.9-pre-release(Oct 28, 2022)

    Pre-release content

    https://github.com/GEC-git/AptaMat

    • Create LICENSE by @GEC-git in https://github.com/GEC-git/AptaMat/pull/2
    • main script AptaMat.py
    • README.MD edited and published
    • Beta AptaMat logo edited and published

    Contributors

    • @GEC-git contributed in https://github.com/GEC-git/AptaMat
    • @GitHuBinet contributed in https://github.com/GEC-git/AptaMat

    Full Changelog: https://github.com/GEC-git/AptaMat/commits/v0.9-pre-release

    Source code(tar.gz)
    Source code(zip)
Owner
GEC UTC
We are the "Genie Enzymatique et Cellulaire" CNRS UMR 7025 research unit.
GEC UTC
Methylation/modified base calling separated from basecalling.

Remora Methylation/modified base calling separated from basecalling. Remora primarily provides an API to call modified bases for basecaller programs s

Oxford Nanopore Technologies 72 Jan 05, 2023
Desafio 1 ~ Bantotal

Challenge 01 | Bantotal Please read the instructions for the challenge by selecting your preferred language below: Español Português License Copyright

Maratona Behind the Code 44 Sep 28, 2022
Nobel Data Analysis

Nobel_Data_Analysis This project is for analyzing a set of data about people who have won the Nobel Prize in different fields and different countries

Mohammed Hassan El Sayed 1 Jan 24, 2022
Python data processing, analysis, visualization, and data operations

Python This is a Python data processing, analysis, visualization and data operations of the source code warehouse, book ISBN: 9787115527592 Descriptio

FangWei 1 Jan 16, 2022
Data analysis and visualisation projects from a range of individual projects and applications

Python-Data-Analysis-and-Visualisation-Projects Data analysis and visualisation projects from a range of individual projects and applications. Python

Tom Ritman-Meer 1 Jan 25, 2022
Visions provides an extensible suite of tools to support common data analysis operations

Visions And these visions of data types, they kept us up past the dawn. Visions provides an extensible suite of tools to support common data analysis

168 Dec 28, 2022
The OHSDI OMOP Common Data Model allows for the systematic analysis of healthcare observational databases.

The OHSDI OMOP Common Data Model allows for the systematic analysis of healthcare observational databases.

Bell Eapen 14 Jan 02, 2023
MapReader: A computer vision pipeline for the semantic exploration of maps at scale

MapReader A computer vision pipeline for the semantic exploration of maps at scale MapReader is an end-to-end computer vision (CV) pipeline designed b

Living with Machines 25 Dec 26, 2022
Python utility to extract differences between two pandas dataframes.

Python utility to extract differences between two pandas dataframes.

Jaime Valero 8 Jan 07, 2023
Flood modeling by 2D shallow water equation

hydraulicmodel Flood modeling by 2D shallow water equation. Refer to Hunter et al (2005), Bates et al. (2010). Diffusive wave approximation Local iner

6 Nov 30, 2022
VevestaX is an open source Python package for ML Engineers and Data Scientists.

VevestaX Track failed and successful experiments as well as features. VevestaX is an open source Python package for ML Engineers and Data Scientists.

Vevesta 24 Dec 14, 2022
Autopsy Module to analyze Registry Hives based on bookmarks provided by EricZimmerman for his tool RegistryExplorer

Autopsy Module to analyze Registry Hives based on bookmarks provided by EricZimmerman for his tool RegistryExplorer

Mohammed Hassan 13 Mar 31, 2022
Very basic but functional Kakuro solver written in Python.

kakuro.py Very basic but functional Kakuro solver written in Python. It uses a reduction to exact set cover and Ali Assaf's elegant implementation of

Louis Abraham 4 Jan 15, 2022
Python-based Space Physics Environment Data Analysis Software

pySPEDAS pySPEDAS is an implementation of the SPEDAS framework for Python. The Space Physics Environment Data Analysis Software (SPEDAS) framework is

SPEDAS 98 Dec 22, 2022
A highly efficient and modular implementation of Gaussian Processes in PyTorch

GPyTorch GPyTorch is a Gaussian process library implemented using PyTorch. GPyTorch is designed for creating scalable, flexible, and modular Gaussian

3k Jan 02, 2023
Minimal working example of data acquisition with nidaqmx python API

Data Aquisition using NI-DAQmx python API Based on this project It is a minimal working example for data acquisition using the NI-DAQmx python API. It

Pablo 1 Nov 05, 2021
PostQF is a user-friendly Postfix queue data filter which operates on data produced by postqueue -j.

PostQF Copyright © 2022 Ralph Seichter PostQF is a user-friendly Postfix queue data filter which operates on data produced by postqueue -j. See the ma

Ralph Seichter 11 Nov 24, 2022
This program analyzes a DNA sequence and outputs snippets of DNA that are likely to be protein-coding genes.

This program analyzes a DNA sequence and outputs snippets of DNA that are likely to be protein-coding genes.

1 Dec 28, 2021
InDels analysis of CRISPR lines by NGS amplicon sequencing technology for a multicopy gene family.

CRISPRanalysis InDels analysis of CRISPR lines by NGS amplicon sequencing technology for a multicopy gene family. In this work, we present a workflow

2 Jan 31, 2022
A set of tools to analyse the output from TraDIS analyses

QuaTradis (Quadram TraDis) A set of tools to analyse the output from TraDIS analyses Contents Introduction Installation Required dependencies Bioconda

Quadram Institute Bioscience 2 Feb 16, 2022